Stem-loop sequence tni-mir-142b

AccessionMI0003262 (change log)
DescriptionTetraodon nigroviridis miR-142b stem-loop
Gene family MIPF0000084; mir-142
Literature search

1 open access papers mention tni-mir-142b
(7 sentences)

Stem-loop
          ug   c           a         uaaacguc 
5' acagugc  uca ccauaaaguag aagcacuac        u
   |||||||  ||| ||||||||||| |||||||||         
3' ugucacg  agu gguauuucauc uuugugaug        u
          ug   a           c         ugacacau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
16: 3999086-3999171 [+]
intergenic
Database links

Mature sequence tni-miR-142b

Accession MIMAT0002946
Sequence

15 - 

cauaaaguagaaagcacuacua

 - 36

Get sequence
Evidence by similarity; MI0002006