Stem-loop sequence fru-let-7a-2

AccessionMI0003313 (change log)
DescriptionFugu rubripes let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
      u   gu                ---------uu    u 
5' ggg gag  aguagguuguauaguu           aggg u
   ||| |||  ||||||||||||||||           |||| a
3' ucc uuc  ucauucaacauaucaa           uccc u
      u   ug                uagacuguccu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602543.1: 10426019-10426094 [+]
intergenic
Database links

Mature sequence fru-let-7a

Accession MIMAT0002928
Sequence

4 - 

ugagguaguagguuguauaguu

 - 25

Get sequence
Evidence by similarity; MI0001857