Stem-loop sequence tni-let-7a-2

AccessionMI0003314 (change log)
DescriptionTetraodon nigroviridis let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   guccuuug   u   gu                ---------uu    u 
5'         ggg gag  aguagguuguauaguu           aggg u
           ||| |||  ||||||||||||||||           |||| a
3'         ucc uuc  ucauucaacauaucaa           uccc u
   --------   u   ug                uagacuguccu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
13: 9220391-9220474 [+]
intergenic
Database links

Mature sequence tni-let-7a

Accession MIMAT0002929
Sequence

12 - 

ugagguaguagguuguauaguu

 - 33

Get sequence
Evidence by similarity; MI0001857