Stem-loop sequence fru-let-7d

AccessionMI0003319 (change log)
DescriptionFugu rubripes let-7d stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   u   -        u u   g   uu            -  gcauaaua 
5'  gug cucugcag g gag uag  gguuguaugguu uc        a
    ||| |||||||| | ||| |||  |||||||||||| ||        a
3'  cac gaggcguc c uuc auc  ccaacaugucaa ag        c
   -   u        c u   g   uu            u  aggcacga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602541.1: 10559842-10559937 [-]
intergenic
Database links

Mature sequence fru-let-7d

Accession MIMAT0002995
Sequence

15 - 

ugagguaguugguuguaugguu

 - 36

Get sequence
Evidence by similarity; MI0001868