Stem-loop sequence tni-let-7d

AccessionMI0003320 (change log)
DescriptionTetraodon nigroviridis let-7d stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   u   -        u u   g   uu            -  gcauaaua 
5'  gug cucugcag g gag uag  gguuguaugguu uc        a
    ||| |||||||| | ||| |||  |||||||||||| ||        a
3'  cac gaggcguc c uuc auc  ccaacaugucaa ag        c
   -   u        c u   g   uu            u  aggcacga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
8: 6075953-6076048 [-]
intergenic
Database links

Mature sequence tni-let-7d

Accession MIMAT0002996
Sequence

15 - 

ugagguaguugguuguaugguu

 - 36

Get sequence
Evidence by similarity; MI0001868