Stem-loop sequence fru-mir-181b

Accession MI0003331
Previous IDs fru-mir-181b-1
Description Fugu rubripes miR-181b stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--aaa  u    aucaa         cug           aa  g 
     gg caca     cauucauug   ucgguggguuu  cu u
     || ||||     |||||||||   |||||||||||  ||  
     cc gugu     guaaguagc   agucacucgag  gg a
uagac  u    -caac         --a           aa  u 
Get sequence
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5) Overlapping transcripts
HE602554.1: 9659865-9659951 [-]
intergenic
Clustered miRNAs
< 10kb from fru-mir-181b
fru-mir-181a-1 HE602554.1: 9660091-9660173 [-]
fru-mir-181b HE602554.1: 9659865-9659951 [-]

Mature sequence fru-miR-181b

Accession MIMAT0003003
Sequence

14 - 

aacauucauugcugucgguggg

 - 35

Get sequence
Evidence by similarity; MI0001366