Stem-loop sequence tni-let-7j

AccessionMI0003342 (change log)
DescriptionTetraodon nigroviridis let-7j stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   gucu         u           ugagggucugugauu 
5'     gagguaguu uuuguacaguu               c
       ||||||||| |||||||||||               u
3'     uuccgucag gaacaugucaa               g
   -ccg         u           ucgaggacauacccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
11: 5230979-5231060 [+]
sense
ENSTNIT00000018032 ; wdr82-201; intron 3
Un_random: 109473928-109474009 [+]
sense
ENSTNIT00000018032 ; wdr82-201; intron 3
Database links

Mature sequence tni-let-7j

Accession MIMAT0003014
Sequence

4 - 

ugagguaguuuuuuguacaguu

 - 25

Get sequence
Evidence by similarity; MI0001874