Stem-loop sequence dre-let-7j

AccessionMI0003343 (change log)
DescriptionDanio rerio let-7j stem-loop
Gene family MIPF0000002; let-7
Literature search

39 open access papers mention dre-let-7j
(198 sentences)

Stem-loop
      u        u            --------uu      cu u 
5' ggu gagguagu guuuguacaguu          uagggu  g u
   ||| |||||||| ||||||||||||          ||||||  | a
3' ccg uuccguca cagacaugucaa          gucccg  c u
      -        u            ucgaggaauu      -u u 
Get sequence
Deep sequencing
20995 reads, 1.21e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This zebrafish miRNA sequence is predicted based on homology with a verified mammalian sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr6: 41454791-41454873 [+]
sense
OTTDART00000024645 ; wdr82-001; intron 2
ENSDART00000007353 ; wdr82-001; intron 2
ENSDART00000007798 ; twf2a-201; intron 2
Database links

Mature sequence dre-let-7j

Accession MIMAT0003015
Sequence

4 - 

ugagguaguuguuuguacaguu

 - 25

Get sequence
Deep sequencing19851 reads, 11 experiments
Evidence by similarity; MI0001874
Database links
Predicted targets