Stem-loop sequence fru-let-7b

AccessionMI0003344 (change log)
DescriptionFugu rubripes let-7b stem-loop
Gene family MIPF0000002; let-7
Stem-loop
        u                     uca  g  g    uuu 
5' caggg gagguaguagguugugugguu   gg uu ugau   g
   ||||| |||||||||||||||||||||   || || ||||    
3' guccc uuccgucauccaacauaucaa   uc ag acua   c
        -                     ---  g  g    ccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602552.1: 6927883-6927966 [-]
intergenic
Database links

Mature sequence fru-let-7b

Accession MIMAT0003016
Sequence

6 - 

ugagguaguagguugugugguu

 - 27

Get sequence
Evidence by similarity; MI0001865