Stem-loop sequence tni-let-7b

AccessionMI0003345 (change log)
DescriptionTetraodon nigroviridis let-7b stem-loop
Gene family MIPF0000002; let-7
Stem-loop
        u                     uca  g  g    uuu 
5' caggg gagguaguagguugugugguu   gg uu ugau   g
   ||||| |||||||||||||||||||||   || || ||||    
3' guccc uuccgucauccaacauaucaa   uc ag acua   c
        -                     ---  g  g    ccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
19: 5327497-5327580 [-]
intergenic
Database links

Mature sequence tni-let-7b

Accession MIMAT0003017
Sequence

6 - 

ugagguaguagguugugugguu

 - 27

Get sequence
Evidence by similarity; MI0001865