Stem-loop sequence dre-mir-212

AccessionMI0003385
DescriptionDanio rerio miR-212 stem-loop
Gene family MIPF0000065; mir-132
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-132. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        u  a   a  -  u     c       c      c  aa gug 
5' gucag gc uca ua cc uggcu uagacug uuacug ua  u   u
   ||||| || ||| || || ||||| ||||||| |||||| ||  |    
3' cgguc ug agu au gg acuga aucugac aaugac au  a   c
        -  c   c  c  u     c       -      -  ga agu 
Get sequence
Deep sequencing
26 reads, 6.33 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was predicted by computational methods using conservation between human, mouse and Fugu rubripes sequences [1]. Expression of the excised miR was validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined.

Genome context
Coordinates (Zv9) Overlapping transcripts
15: 25232253-25232346 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-212
dre-mir-21215: 25232253-25232346 [+]
dre-mir-132-115: 25232522-25232606 [+]
Database links

Mature sequence dre-miR-212

Accession MIMAT0003049
Sequence

61 - 

uaacagucuacagucauggcu

 - 81

Get sequence
Deep sequencing10 reads, 4 experiments
Evidence experimental; PCR [1]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).