Stem-loop sequence tni-mir-29a-2

Accession MI0003404
Description Tetraodon nigroviridis miR-29a-2 stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-uguuuc     caaaag            cuc       --u  a  c c 
       uccac      augacugauuuc   uggugcu   ag gc g c
       |||||      ||||||||||||   |||||||   || || |  
       aggug      uauuggcuaaag   accacga   uc cg c u
cgugacu     ucaaaa            uuu       ucu  -  a g 
Get sequence
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
Un_random: 8673465-8673564 [+]
intergenic
Clustered miRNAs
< 10kb from tni-mir-29a-2
tni-mir-29b-1 Un_random: 8673324-8673402 [+]
tni-mir-29a-2 Un_random: 8673465-8673564 [+]

Mature sequence tni-miR-29a

Accession MIMAT0003054
Sequence

60 - 

uagcaccauuugaaaucgguua

 - 81

Get sequence
Evidence by similarity; MI0001938