Stem-loop sequence fru-let-7a-1

AccessionMI0003407 (change log)
DescriptionFugu rubripes let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   c   uu   g   u             ---gaga   a 
5'  agg  gag uag agguuguauaguu       gug c
    |||  ||| ||| |||||||||||||       |||  
3'  ucc  uuc auc uccgacaugucag       cac a
   -   cu   g   c             uagagga   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602549.1: 9611356-9611429 [+]
intergenic
Clustered miRNAs
< 10kb from fru-let-7a-1
fru-mir-100HE602549.1: 9610912-9610974 [+]
fru-let-7a-1HE602549.1: 9611356-9611429 [+]
fru-mir-125bHE602549.1: 9617257-9617326 [+]
Database links

Mature sequence fru-let-7a

Accession MIMAT0002928
Sequence

6 - 

ugagguaguagguuguauaguu

 - 27

Get sequence
Evidence by similarity; MI0001857