Stem-loop sequence tni-let-7a-1

AccessionMI0003408 (change log)
DescriptionTetraodon nigroviridis let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   c    u   g   u              ---aga   a 
5'  aggg gag uag agguuguauaguug      gug c
    |||| ||| ||| ||||||||||||||      |||  
3'  uccc uuc auc uccgacaugucaau      cac a
   -    u   g   c              agagga   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
7: 5619181-5619254 [-]
intergenic
Clustered miRNAs
< 10kb from tni-let-7a-1
tni-mir-1007: 5619635-5619697 [-]
tni-let-7a-17: 5619181-5619254 [-]
tni-mir-125b7: 5613623-5613717 [-]
Database links

Mature sequence tni-let-7a

Accession MIMAT0002929
Sequence

6 - 

ugagguaguagguuguauaguu

 - 27

Get sequence
Evidence by similarity; MI0001857