Stem-loop sequence tni-mir-128-1

AccessionMI0003422 (change log)
DescriptionTetraodon nigroviridis miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
         uac        ga      uu    g  ca 
5' gcugca   ggggccgg  cgcugu  gaga uc  c
   ||||||   ||||||||  ||||||  |||| ||   
3' cgacgu   cucuggcc  gugaca  cucu ag  u
         uuu        aa      --    a  ua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
3: 4160307-4160378 [-]
sense
ENSTNIT00000013460 ; r3hdm1-201; intron 21
Database links

Mature sequence tni-miR-128

Accession MIMAT0003019
Sequence

46 - 

ucacagugaaccggucucuuuu

 - 67

Get sequence
Evidence by similarity; MI0001980