Stem-loop sequence fru-let-7g

AccessionMI0003461 (change log)
DescriptionFugu rubripes let-7g stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   u    u   gu     u          ----uua     ac 
5'  ggga gag  aguag uuguauaguu       ggauc  a
    |||| |||  ||||| ||||||||||       |||||   
3'  cccu uuc  ucauc gacauaucaa       ucuag  c
   a    -   ug     u          uagaggg     ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602537.1: 6725744-6725822 [+]
intergenic
Clustered miRNAs
< 10kb from fru-let-7g
fru-let-7gHE602537.1: 6725744-6725822 [+]
fru-let-7hHE602537.1: 6726015-6726098 [+]
Database links

Mature sequence fru-let-7g

Accession MIMAT0003097
Sequence

6 - 

ugagguaguaguuuguauaguu

 - 27

Get sequence
Evidence by similarity; MI0001874