Stem-loop sequence tni-let-7g

AccessionMI0003462 (change log)
DescriptionTetraodon nigroviridis let-7g stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   u    u   gu     u          ----uua     ac 
5'  ggga gag  aguag uuguauaguu       ggauc  a
    |||| |||  ||||| ||||||||||       |||||   
3'  cccu uuc  ucauc gacauaucaa       ucuag  c
   a    -   ug     u          uagaggg     ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
9: 3596157-3596235 [+]
sense
ENSTNIT00000018363 ; huwe1 (2 of 2)-201; intron 34
Clustered miRNAs
< 10kb from tni-let-7g
tni-let-7g9: 3596157-3596235 [+]
tni-let-7h9: 3596422-3596520 [+]
Database links

Mature sequence tni-let-7g

Accession MIMAT0003098
Sequence

6 - 

ugagguaguaguuuguauaguu

 - 27

Get sequence
Evidence by similarity; MI0001874