![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-383 |
|||||
Accession | MI0003478 (change log) | ||||
Description | Rattus norvegicus miR-383 stem-loop | ||||
Gene family | MIPF0000137; mir-383 | ||||
Literature search |
![]()
16 open access papers mention rno-mir-383 | ||||
Stem-loop |
----uccuca aa a uug gga 5' gaucag ggug cuguggcu ggu u |||||| |||| |||||||| ||| 3' cugguc ucac gacaccga cua a acgagaaaga cg - --- auu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-383-5p |
|
Accession | MIMAT0003114 |
Previous IDs | rno-miR-383 |
Sequence |
5 - cagaucagaaggugacugugg - 25 |
Deep sequencing | 65697 reads, 310 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-383-3p |
|
Accession | MIMAT0017197 |
Previous IDs | rno-miR-383* |
Sequence |
47 - ccacagcacugccuggucaga - 67 |
Deep sequencing | 597 reads, 93 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|