Stem-loop sequence rno-mir-207

AccessionMI0003479 (change log)
DescriptionRattus norvegicus miR-207 stem-loop
Gene family MIPF0000241; mir-207
Literature search

7 open access papers mention rno-mir-207
(15 sentences)

Stem-loop
   -   c     u ag    ug           -    g ag 
5'  agg agggg g  gggc  cgggaggagcg gggc g  g
    ||| ||||| |  ||||  ||||||||||| |||| |   
3'  uuc uuccc c  cucg  guccucuucgc uucg c  c
   u   u     u cu    --           g    g gu 
Get sequence
Deep sequencing
34 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 57028859-57028936 [+]
sense
ENSRNOT00000010061 ; Dnaja1-201; intron 1
Database links

Mature sequence rno-miR-207

Accession MIMAT0003115
Sequence

52 - 

cuucuccuggcucuccucccuuu

 - 74

Get sequence
Deep sequencing24 reads, 21 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).