![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-224 |
|||||
Accession | MI0003483 (change log) | ||||
Description | Rattus norvegicus miR-224 stem-loop | ||||
Gene family | MIPF0000088; mir-224 | ||||
Literature search |
![]()
11 open access papers mention rno-mir-224 | ||||
Stem-loop |
ca u u a u ug uu 5' gggcuuu agucacuag ggu ccguuu g aga gu u ||||||| ||||||||| ||| |||||| | ||| || 3' cccgaaa ucagugauc ccg gguaaa c uuu ua u ca - u a - gu cg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-224-5p |
|
Accession | MIMAT0003119 |
Previous IDs | rno-miR-224 |
Sequence |
8 - caagucacuagugguuccguuu - 29 |
Deep sequencing | 6655 reads, 371 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-224-3p |
|
Accession | MIMAT0017200 |
Previous IDs | rno-miR-224* |
Sequence |
55 - aaauggugcccuagugacuaca - 76 |
Deep sequencing | 73 reads, 54 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|