Stem-loop sequence mmu-mir-483

Accession

MI0003484

Symbol

MGI:Mir483

Description

Mus musculus miR-483 stem-loop

Gene family

MIPF0000180; mir-483

Stem-loop

          -          aa   aa   a u   uuu 
5' gaggggg aagacgggag  gag  ggg g ggu   u
   ||||||| ||||||||||  |||  ||| | |||    
3' cucucuu uucugcccuc  cuc  cuc c ccg   g
          g          cc   --   a u   ugg 

Deep sequencing

14683 reads, 100 reads per million, 78 experiments

Confidence

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38): chr7: 142654924-142654996 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000111235 ; Igf2-007; intron 1

  OTTMUST00000035617 ; Igf2-001; intron 2

  OTTMUST00000035618 ; Igf2-002; intron 2

  OTTMUST00000035619 ; Igf2-003; intron 2

  OTTMUST00000035620 ; Igf2-004; intron 2

  OTTMUST00000035621 ; Igf2-005; intron 2

  ENSMUST00000178921 ; Igf2-007; intron 1

  ENSMUST00000000033 ; Igf2-001; intron 2

  ENSMUST00000121128 ; Igf2-002; intron 2

  ENSMUST00000105936 ; Igf2-003; intron 2

  ENSMUST00000105935 ; Igf2-004; intron 2

  ENSMUST00000145896 ; Igf2-005; intron 2

  ENSMUST00000097936 ; Igf2-201; intron 2

Database links

• MIRBASE-TRACKER:MI0003484
• ENTREZGENE: 723874;Mir483
• MGI: 3619420;Mir483

Mature sequence mmu-miR-483-5p

• Accession: MIMAT0004782
• Previous IDs: mmu-miR-483
• Sequence: 8 - aagacgggagaagagaagggag - 29
• Deep sequencing: 3498 reads, 54 experiments
• Evidence: experimental; cloned [1], Illumina [2-3]
• Validated targets:
  • MIRTARBASE:mmu-miR-483-5p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-483-5p
  • MICRORNA.ORG:mmu-miR-483-5p
  • MIRDB:mmu-miR-483-5p
  • RNA22-MMU:mmu-miR-483-5p
  • TARGETSCAN-VERT:mmu-miR-483

Mature sequence mmu-miR-483-3p

• Accession: MIMAT0003120
• Previous IDs: mmu-miR-483;mmu-miR-483*
• Sequence: 45 - ucacuccuccccucccgucuu - 65
• Deep sequencing: 3818 reads, 35 experiments
• Evidence: experimental; cloned [1], Illumina [2-3]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-483-3p
  • MICRORNA.ORG:mmu-miR-483-3p
  • MIRDB:mmu-miR-483-3p
  • RNA22-MMU:mmu-miR-483-3p

References

1. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).