Stem-loop sequence mmu-mir-483

AccessionMI0003484
Symbol MGI:Mir483
DescriptionMus musculus miR-483 stem-loop
Gene family MIPF0000180; mir-483
Stem-loop
          -          aa   aa   a u   uuu 
5' gaggggg aagacgggag  gag  ggg g ggu   u
   ||||||| ||||||||||  |||  ||| | |||    
3' cucucuu uucugcccuc  cuc  cuc c ccg   g
          g          cc   --   a u   ugg 
Get sequence
Deep sequencing
14683 reads, 100 reads per million, 78 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr7: 142654924-142654996 [-]
sense
OTTMUST00000111235 ; Igf2-007; intron 1
OTTMUST00000035617 ; Igf2-001; intron 2
OTTMUST00000035618 ; Igf2-002; intron 2
OTTMUST00000035619 ; Igf2-003; intron 2
OTTMUST00000035620 ; Igf2-004; intron 2
OTTMUST00000035621 ; Igf2-005; intron 2
ENSMUST00000178921 ; Igf2-007; intron 1
ENSMUST00000000033 ; Igf2-001; intron 2
ENSMUST00000121128 ; Igf2-002; intron 2
ENSMUST00000105936 ; Igf2-003; intron 2
ENSMUST00000105935 ; Igf2-004; intron 2
ENSMUST00000145896 ; Igf2-005; intron 2
ENSMUST00000097936 ; Igf2-201; intron 2
Database links

Mature sequence mmu-miR-483-5p

Accession MIMAT0004782
Previous IDsmmu-miR-483
Sequence

8 - 

aagacgggagaagagaagggag

 - 29

Get sequence
Deep sequencing3498 reads, 54 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Validated targets
Predicted targets

Mature sequence mmu-miR-483-3p

Accession MIMAT0003120
Previous IDsmmu-miR-483;mmu-miR-483*
Sequence

45 - 

ucacuccuccccucccgucuu

 - 65

Get sequence
Deep sequencing3818 reads, 35 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).