![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-485 |
||||||||||||||||||||||||||||||||||||
Accession | MI0003492 (change log) | |||||||||||||||||||||||||||||||||||
Symbol | MGI:Mir485 | |||||||||||||||||||||||||||||||||||
Description | Mus musculus miR-485 stem-loop | |||||||||||||||||||||||||||||||||||
Gene family | MIPF0000201; mir-485 | |||||||||||||||||||||||||||||||||||
Literature search |
![]()
19 open access papers mention mmu-mir-485 | |||||||||||||||||||||||||||||||||||
Stem-loop |
u cu - a auuc 5' acu ggagagagg ggccgug auga uucg a ||| ||||||||| ||||||| |||| |||| u 3' uga cuucucucc ucggcac uacu gagc c u uc a - aaau |
|||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||||||||||||
Comments |
miR-485-3p was predicted by Sewer et al [1], and its expression later verified experimentally by Mineno et al using MPSS technology [2]. The MPSS protocol used provides 22nt sequences, but the true extents of the mature miRNA are not reliably obtained. Landgraf et al. show that the 5' product is the predominant one [3]. |
|||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-485-5p |
|
Accession | MIMAT0003128 |
Previous IDs | mmu-miR-485-5p;mmu-miR-485 |
Sequence |
9 - agaggcuggccgugaugaauuc - 30 |
Deep sequencing | 30806 reads, 79 experiments |
Evidence | experimental; cloned [1,3], MPSS [2], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-485-3p |
|
Accession | MIMAT0003129 |
Previous IDs | mmu-miR-485-3p;mmu-miR-485* |
Sequence |
45 - agucauacacggcucuccucuc - 66 |
Deep sequencing | 14400 reads, 83 experiments |
Evidence | experimental; MPSS [2], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|