Stem-loop sequence mmu-mir-485

AccessionMI0003492 (change log)
Symbol MGI:Mir485
DescriptionMus musculus miR-485 stem-loop
Gene family MIPF0000201; mir-485
Literature search

19 open access papers mention mmu-mir-485
(31 sentences)

Stem-loop 
      u         cu       -    a    auuc 
5' acu ggagagagg  ggccgug auga uucg    a
   ||| |||||||||  ||||||| |||| ||||    u
3' uga cuucucucc  ucggcac uacu gagc    c
      u         uc       a    -    aaau
Get sequence
Deep sequencing
45221 reads, 158 reads per million, 89 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR-485-3p was predicted by Sewer et al [1], and its expression later verified experimentally by Mineno et al using MPSS technology [2]. The MPSS protocol used provides 22nt sequences, but the true extents of the mature miRNA are not reliably obtained. Landgraf et al. show that the 5' product is the predominant one [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109734902-109734974 [+]
sense
OTTMUST00000114051 ; Mirg-010; exon 6
OTTMUST00000114052 ; Mirg-009; exon 7
OTTMUST00000114049 ; Mirg-011; exon 10
ENSMUST00000093620 ; Mir485-201; exon 1
ENSMUST00000182185 ; Mirg-010; exon 6
ENSMUST00000182499 ; Mirg-009; exon 7
ENSMUST00000183144 ; Mirg-011; exon 10
Clustered miRNAs
< 10kb from mmu-mir-485
mmu-mir-381chr12: 109726822-109726896 [+]
mmu-mir-487bchr12: 109727333-109727414 [+]
mmu-mir-539chr12: 109728129-109728202 [+]
mmu-mir-544chr12: 109729325-109729402 [+]
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
mmu-mir-668chr12: 109734732-109734797 [+]
mmu-mir-485chr12: 109734902-109734974 [+]
mmu-mir-453chr12: 109735619-109735700 [+]
mmu-mir-154chr12: 109738433-109738498 [+]
mmu-mir-496achr12: 109739119-109739197 [+]
mmu-mir-377chr12: 109740510-109740577 [+]
mmu-mir-541chr12: 109742409-109742498 [+]
mmu-mir-409chr12: 109743158-109743236 [+]
mmu-mir-412chr12: 109743289-109743368 [+]
mmu-mir-369chr12: 109743418-109743496 [+]
mmu-mir-410chr12: 109743715-109743795 [+]
Database links

Mature sequence mmu-miR-485-5p

Accession MIMAT0003128
Previous IDsmmu-miR-485-5p;mmu-miR-485
Sequence

9 -  

agaggcuggccgugaugaauuc

 - 30

Get sequence
Deep sequencing30806 reads, 79 experiments
Evidence experimental; cloned [1,3], MPSS [2], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-485-3p

Accession MIMAT0003129
Previous IDsmmu-miR-485-3p;mmu-miR-485*
Sequence

45 -  

agucauacacggcucuccucuc

 - 66

Get sequence
Deep sequencing14400 reads, 83 experiments
Evidence experimental; MPSS [2], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).