miRBase entry: hsa-mir-539

Stem-loop hsa-mir-539


Accession
MI0003514
Symbol
HGNC: MIR539
Description
Homo sapiens hsa-mir-539 precursor miRNA
Gene family
MIPF0000018; mir-154

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR539 is a microRNA that is part of the miR655 miRNA cluster, which contains a total of 20 miRNAs. Nine of these miRNAs, including MIR539, have available expression data [PMC7465874]. MIR539 has been found to be either upregulated or downregulated in colorectal cancer cases with subsequent relapse, as part of a 5-miRNA signature [PMC5110606]. In non-small cell lung cancer cells, targeting DCLK1 with MIR539 has been shown to increase sensitivity to cisplatin [PMC7904745]. Additionally, MIR539 has been found to be involved in mitochondrial fission and cardiac apoptosis in cardiomyocytes [PMC7123062]. It has also been identified as a sponge for cardiac apoptosis-related lncRNA and regulates PHB2 expression [PMC7123062]. In rat models of myocardial infarction, increased expression of MIR539 inhibits the expression of MEK and leads to impaired proliferation and apoptosis of cardiomyocytes [PMC7527411]. Furthermore, MIR539 is located in the DLK1-DIO3 imprinting region that contains a microRNA cluster involved in leukemia pathogenesis [PMC4633733]. It has also been suggested that MIR539 may contribute to erythropoiesis based on progressive hypomethylation observed during the differentiation process from hematopoietic stem cells to erythroid progenitors [PMC4633733]. Additionally, down-regulation of MIR539 promotes MMP8 expression and activates TGF-β1 signaling in hepatocellular carcinoma progression [PMC8712501].

Literature search
27 open access papers mention hsa-mir-539
(87 sentences)

Sequence

4263 reads, 83 reads per million, 70 experiments
auacuugaGGAGAAAUUAUCCUUGGUGUGUucgcuuuauuuaugaugaAUCAUACAAGGACAAUUUCUUUuugaguau
(((((((((((((((((.((((((.(((((((((.........).)))).)))))))))).)))))))))))))))))

Structure
                 A      G    -    - uuu 
auacuugaGGAGAAAUU UCCUUG UGUG Uucg c   a
||||||||||||||||| |||||| |||| |||| |   u
uaugaguuUUUCUUUAA AGGAAC AUAC Aagu g   u
                 C      -    U    a uau 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101047321-101047398 [+]
Clustered miRNAs
19 other miRNAs are < 10 kb from hsa-mir-539
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-539 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-539-5p

Accession MIMAT0003163
Description Homo sapiens hsa-miR-539-5p mature miRNA
Sequence 9 - GGAGAAAUUAUCCUUGGUGUGU - 30
Evidence experimental
cloned [1,3], miRAP-cloned [2]

Mature hsa-miR-539-3p

Accession MIMAT0022705
Description Homo sapiens hsa-miR-539-3p mature miRNA
Sequence 49 - AUCAUACAAGGACAAUUUCUUU - 70
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  3. PubMed ID: 16973894
    Mouse microRNA profiles determined with a new and sensitive cloning method
    "Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H"
    "Nucleic Acids Res (2006) 34:e115