Stem-loop sequence mmu-mir-547

Accession MI0003523
Symbol MGI:Mir547
Description Mus musculus miR-547 stem-loop
Gene family MIPF0000779; mir-547
Stem-loop
     a   a     ug           cc   uuaaca g 
gugug ugu ucacu  aggauguacca  cau      g a
||||| ||| |||||  |||||||||||  |||      |  
cacac aua aguga  uucuacauggu  gua      c a
     a   g     gu           uc   ------ a 
Get sequence
Deep sequencing
1470 reads, 37 experiments
Comments

The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence [2].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chrX: 67988374-67988451 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-547
mmu-mir-547 chrX: 67988374-67988451 [-]
mmu-mir-201 chrX: 67988096-67988161 [-]
Database links

Mature sequence mmu-miR-547-5p

Accession MIMAT0017210
Previous IDs mmu-miR-547*
Sequence

12 - 

cacuugaggauguaccaccca

 - 32

Get sequence
Deep sequencing 14 reads, 8 experiments
Evidence experimental; Solexa [4]
Predicted targets

Mature sequence mmu-miR-547-3p

Accession MIMAT0003173
Previous IDs mmu-miR-547
Sequence

49 - 

cuugguacaucuuugagugag

 - 69

Get sequence
Deep sequencing 1453 reads, 36 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).