|
miRBase |
|
Stem-loop sequence mmu-mir-547 |
||||||
| Accession | MI0003523 | |||||
| Symbol | MGI:Mir547 | |||||
| Description | Mus musculus miR-547 stem-loop | |||||
| Gene family | MIPF0000779; mir-547 | |||||
| Stem-loop |
a a ug cc uuaaca g gugug ugu ucacu aggauguacca cau g a ||||| ||| ||||| ||||||||||| ||| | cacac aua aguga uucuacauggu gua c a a g gu uc ------ a |
|||||
| Deep sequencing |
| |||||
| Comments |
The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence [2]. |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links | ||||||
Mature sequence mmu-miR-547-5p |
|
| Accession | MIMAT0017210 |
| Previous IDs | mmu-miR-547* |
| Sequence |
12 - cacuugaggauguaccaccca - 32 |
| Deep sequencing | 14 reads, 8 experiments |
| Evidence | experimental; Solexa [4] |
| Predicted targets |
|
Mature sequence mmu-miR-547-3p |
|
| Accession | MIMAT0003173 |
| Previous IDs | mmu-miR-547 |
| Sequence |
49 - cuugguacaucuuugagugag - 69 |
| Deep sequencing | 1453 reads, 36 experiments |
| Evidence | experimental; cloned [1-2], Solexa [3-4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|