![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-541 |
||||||||||||||||||||||||||||||||||
Accession | MI0003527 (change log) | |||||||||||||||||||||||||||||||||
Description | Rattus norvegicus miR-541 stem-loop | |||||||||||||||||||||||||||||||||
Gene family | MIPF0000213; mir-541 | |||||||||||||||||||||||||||||||||
Literature search |
5 open access papers mention rno-mir-541 | |||||||||||||||||||||||||||||||||
Stem-loop |
a u aag a g a uccaaga 5' gcca aa cagag ggauucug uguu gucac c a |||| || ||||| |||||||| |||| ||||| | u 3' cggu uu gucuc ccuaagac acaa cggug g u a c aua - g a uaaaauu |
|||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||
Database links |
Mature sequence rno-miR-541-5p |
|
Accession | MIMAT0003177 |
Previous IDs | rno-miR-541 |
Sequence |
14 - aagggauucugauguuggucacacu - 38 |
Deep sequencing | 443251 reads, 480 experiments |
Evidence | experimental; cloned [2], SOLiD [3] |
Predicted targets |
|
Mature sequence rno-miR-541-3p |
|
Accession | MIMAT0017213 |
Previous IDs | rno-miR-541* |
Sequence |
56 - aguggcgaacacagaauccauac - 78 |
Deep sequencing | 427 reads, 133 experiments |
Evidence | experimental; SOLiD [3] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|