miRBase entry: mmu-mir-291b

Stem-loop mmu-mir-291b


Accession
MI0003539
Symbol
MGI: Mir291b
Description
Mus musculus mmu-mir-291b precursor miRNA
Gene family
MIPF0000068; mir-290

Literature search
21 open access papers mention mmu-mir-291b
(143 sentences)

Sequence

9951 reads, 561 reads per million, 44 experiments
acauacagugucGAUCAAAGUGGAGGCCCUCUCCgcggcuuggcgggAAAGUGCAUCCAUUUUGUUUGUcucugugugu
((((((((.(.(((.(((((((((.((.((.(((((......)))))..)).)).))))))))).))).).))))))))

Structure
        u u   U         G  C  -C     gg 
acauacag g cGA CAAAGUGGA GC CU  UCCgc  c
|||||||| | ||| ||||||||| || ||  |||||   
uguguguc c GUU GUUUUACCU CG GA  gggcg  u
        u U   U         A  U  AA     gu 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr7: 3219482-3219560 [+]
Clustered miRNAs
8 other miRNAs are < 10 kb from mmu-mir-291b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-291b-5p

Accession MIMAT0003189
Description Mus musculus mmu-miR-291b-5p mature miRNA
Sequence 13 - GAUCAAAGUGGAGGCCCUCUCC - 34
Evidence experimental
cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-291b-3p

Accession MIMAT0003190
Description Mus musculus mmu-miR-291b-3p mature miRNA
Sequence 48 - AAAGUGCAUCCAUUUUGUUUGU - 69
Evidence experimental
cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267