|
miRBase |
|
Stem-loop sequence rno-mir-379 |
|||||
| Accession | MI0003541 | ||||
| Description | Rattus norvegicus miR-379 stem-loop | ||||
| Gene family | MIPF0000126; mir-379 | ||||
| Stem-loop |
u uuc c g a ga - uua gg cug agag uggu gacuaug acguagg cg u || ||| |||| |||| ||||||| ||||||| || g cc gac ucuc auca cugguac uguaucc gu u a uau - a c aa a cuu |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links |
|
||||
Mature sequence rno-miR-379-5p |
|
| Accession | MIMAT0003192 |
| Previous IDs | rno-miR-379 |
| Sequence |
16 - ugguagacuauggaacguagg - 36 |
| Evidence | experimental; cloned [2], SOLiD [3] |
| Predicted targets |
|
Mature sequence rno-miR-379-3p |
|
| Accession | MIMAT0004791 |
| Previous IDs | rno-miR-379* |
| Sequence |
52 - cuauguaacaugguccacuaac - 73 |
| Evidence | experimental; cloned [2], SOLiD [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|