![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-376c |
||||||||||||||||||||||||||||||||||||||
Accession | MI0003543 (change log) | |||||||||||||||||||||||||||||||||||||
Description | Rattus norvegicus miR-376c stem-loop | |||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000091; mir-368 | |||||||||||||||||||||||||||||||||||||
Literature search |
![]()
8 open access papers mention rno-mir-376c | |||||||||||||||||||||||||||||||||||||
Stem-loop |
u gu u g ua u uggua 5' ug auu aaaa gugga uuccu cuauguuua u || ||| |||| ||||| ||||| ||||||||| u 3' ac uga uuuu cacuu aagga gauacaaau u a ug c g ua - uagua |
|||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||
Database links |
Mature sequence rno-miR-376c-5p |
|
Accession | MIMAT0017219 |
Previous IDs | rno-miR-376c* |
Sequence |
15 - guggauauuccuucuauguuu - 35 |
Deep sequencing | 30412 reads, 350 experiments |
Evidence | experimental; SOLiD [3] |
Predicted targets |
|
Mature sequence rno-miR-376c-3p |
|
Accession | MIMAT0003194 |
Previous IDs | rno-miR-376c |
Sequence |
52 - aacauagaggaaauuucacgu - 72 |
Deep sequencing | 11972 reads, 343 experiments |
Evidence | experimental; cloned [2], SOLiD [3] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|