miRBase entry: rno-mir-382

Stem-loop rno-mir-382


Accession
MI0003548
Description
Rattus norvegicus rno-mir-382 precursor miRNA
Gene family
MIPF0000018; mir-154

Literature search
10 open access papers mention rno-mir-382
(154 sentences)

Sequence

68168 reads, 5035 reads per million, 409 experiments
gguacuugaagaGAAGUUGUUCGUGGUGGAUUCGcuuuacuugugacgAAUCAUUCACGGACAACACUUuuuucaguacc
((((((.(((((((.(((((((((((..(((((((.........).))))))..)))))))))))..)))))))))))))

Structure
      u       -A           UG      - uuu 
gguacu gaagaGA  GUUGUUCGUGG  GAUUCG c   a
|||||| |||||||  |||||||||||  |||||| |   c
ccauga cuuuuUU  CAACAGGCACU  CUAAgc g   u
      -       CA           UA      a ugu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr6: 133884178-133884257 [+]
Clustered miRNAs
20 other miRNAs are < 10 kb from rno-mir-382
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-382-5p

Accession MIMAT0003201
Description Rattus norvegicus rno-miR-382-5p mature miRNA
Sequence 13 - GAAGUUGUUCGUGGUGGAUUCG - 34
Evidence experimental
cloned [3], SOLiD [4]

Mature rno-miR-382-3p

Accession MIMAT0003202
Description Rattus norvegicus rno-miR-382-3p mature miRNA
Sequence 49 - AAUCAUUCACGGACAACACUU - 69
Evidence experimental
cloned [2], Northern [2], SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267