MIR579 is a microRNA that has been implicated in various biological processes and diseases. In patients with bevacizumab-induced cardiotoxicity, the expression of MIR579 was found to be specifically elevated, along with miR1254, and miR1254 showed the strongest association with the clinical diagnosis of cardiotoxicity [PMC7578723]. When an artificial CNNC motif was engineered in MIR579, there was no increase in processing [PMC5340965]. However, a combination of CNNC and stem length reduction resulted in a stronger increase in processing relative to the wild-type construct [PMC5340965]. MIR579 does not contain a CNNC motif within the enriched distances [PMC5340965]. Inhibition of MIR579 leads to higher expression of Ang-1, occludin, and SIRT1 [PMC9563036]. The cPWWP2A protein alleviates diabetes mellitus-induced retinal vascular dysfunction by inhibiting MIR579 activity [PMC9563036]. The minor (T)-allele of rs2910931 upstream of MIR579 leads to increased expression of hsa-miR-579-3p and more effective repression of SLC6A2 expression along with higher synaptic noradrenaline levels in vivo resulting in higher trait anxiety in healthy individuals possibly due to increased activation of midbrain and limbic areas during fear processing. This allele is also associated with Parkinson's disease mediated by increased sympathetic noradrenergic arousal when entering contexts of potential threat [PMC6195525]. Conservation analysis has shown that MIR579 is only conserved among certain primate species and its seed sequence is incompletely conserved in more distantly related species such as mice or rats. The regulation and function of MIR579 are still not fully understood [PMC6195525].
cauauuag a CG aa guu augcaaaaguaaUCGCGGUUUGUGCCAGAUGA auuug u ||| |||||||||||||||||||||||||||||||| ||||| caa uacguuuuuaUUAGCGCCAAAUAUGGUUUACU Uaaau u -------- c -- aa
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003244 |
Description | Homo sapiens hsa-miR-579-3p mature miRNA |
Sequence | 62 - UUCAUUUGGUAUAAACCGCGAUU - 84 |
Evidence |
experimental
SAGE [1], cloned [2], Illumina [3] |
Database links | |
Predicted targets |
Accession | MIMAT0026616 |
Description | Homo sapiens hsa-miR-579-5p mature miRNA |
Sequence | 25 - UCGCGGUUUGUGCCAGAUGACG - 46 |
Evidence |
experimental
Illumina [3] |
Database links | |
Predicted targets |
|