MIR598 is a microRNA gene that has been closely examined in the context of 8p23.1 duplication syndrome. Through SNP array analysis, it was found that MIR598 is located in the core duplicated interval of this syndrome, along with other dosage sensitive genes such as SOX7, TNKS1, MIR124-1 [PMC7947009]. MIR598 has been implicated in various aspects of colorectal cancer (CRC). It has been shown to inhibit metastasis in CRC by suppressing the JAG1-Notch2 pathway and stimulating epithelial-mesenchymal transition [PMC6287550]. Additionally, MIR598 plays a negative role by regulating cMyc, K-Ras, and KLF4 [PMC7602903]. It also suppresses epithelial-mesenchymal transition by inhibiting the Notch pathway [PMC7602903]. However, it is worth noting that there is some uncertainty regarding the classification of MIR598 as a microRNA gene. While it was initially predicted to be a miRNA gene [PMC3667022]'>PMC3667022], subsequent analysis did not include the sequence of mature miRNA MIR598 and thus it has been reclassified as an unknown messenger-like non-coding RNA [PMC3667022]. Overall, MIR598 appears to have potential implications in neuropsychiatric disorders such as autism spectrum disorder and compromised neurocognition in 8p23.1 duplication syndrome patients [PMC7947009] [PMC4268894].
g - ugcugc c CC -A gga cuug auga ugaug ugGCGGUGAU CGAUGGUGUG GCu a |||| |||| ||||| |||||||||| |||||||||| ||| gagc uacu acuac ACUGCUACUG GCUACUGCAU ugg a - c ------ u UU cg ggu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003266 |
Description | Homo sapiens hsa-miR-598-3p mature miRNA |
Sequence | 61 - UACGUCAUCGUUGUCAUCGUCA - 82 |
Evidence |
experimental
Microarray [1], SAGE [1], cloned [2], Illumina [3] |
Database links | |
Predicted targets |
Accession | MIMAT0026620 |
Description | Homo sapiens hsa-miR-598-5p mature miRNA |
Sequence | 24 - GCGGUGAUCCCGAUGGUGUGAGC - 46 |
Evidence |
experimental
Illumina [3] |
|