Stem-loop sequence hsa-mir-605

AccessionMI0003618 (change log)
Symbol HGNC:MIR605
DescriptionHomo sapiens miR-605 stem-loop
Gene family MIPF0000528; mir-605
Literature search

10 open access papers mention hsa-mir-605
(34 sentences)

Stem-loop 
   gc                   c              cu  gg 
5'   ccuagcuugguucuaaauc cauggugccuucuc  ug  a
     ||||||||||||||||||| ||||||||||||||  ||  a
3'   ggauugaacuaagauuuag guaucacggaagag  ac  a
   --                   a              --  aa
Get sequence
Deep sequencing
753 reads, 20.8 reads per million, 106 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 51299573-51299655 [+]
antisense
OTTHUMT00000467541 ; AGAP8-006; intron 1
OTTHUMT00000048029 ; RP11-592B15.4-001; intron 9
ENST00000602930 ; AGAP8-006; intron 1
ENST00000399508 ; RP11-592B15.3-201; intron 3
ENST00000432221 ; RP11-592B15.3-202; intron 3
ENST00000404618 ; RP11-592B15.4-001; intron 9
Database links

Mature sequence hsa-miR-605-5p

Accession MIMAT0003273
Sequence

16 -  

uaaaucccauggugccuucuccu

 - 38

Get sequence
Deep sequencing380 reads, 68 experiments
Evidence experimental; SAGE [1]
Predicted targets

Mature sequence hsa-miR-605-3p

Accession MIMAT0026621
Sequence

51 -  

agaaggcacuaugagauuuaga

 - 72

Get sequence
Deep sequencing367 reads, 77 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).