![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-625 |
|||||
Accession | MI0003639 (change log) | ||||
Symbol | HGNC:MIR625 | ||||
Description | Homo sapiens miR-625 stem-loop | ||||
Gene family | MIPF0000534; mir-625 | ||||
Literature search |
![]()
40 open access papers mention hsa-mir-625 | ||||
Stem-loop |
uaau 5' aggguagagggaugagggggaaaguucuauaguccug u ||||||||||||||||||||||||||||||||||||| a 3' ucccgucucccuacucccccuuucaagauaucaggac g ucua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-625-5p |
|
Accession | MIMAT0003294 |
Previous IDs | hsa-miR-625 |
Sequence |
15 - agggggaaaguucuauagucc - 35 |
Deep sequencing | 12247 reads, 153 experiments |
Evidence | experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-625-3p |
|
Accession | MIMAT0004808 |
Previous IDs | hsa-miR-625* |
Sequence |
52 - gacuauagaacuuucccccuca - 73 |
Deep sequencing | 6937 reads, 149 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16505370
"The colorectal microRNAome"
Proc Natl Acad Sci U S A. 103:3687-3692(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|