miRBase entry: hsa-mir-33b

Stem-loop hsa-mir-33b


Accession
MI0003646
Symbol
HGNC: MIR33B
Description
Homo sapiens hsa-mir-33b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR33B is a microRNA with a tumor suppressor role, typically under-expressed in multiple myeloma (MM) patients [PMC5721125]. It is located in the intron 17 of the SREBF-1 gene locus in humans, and this gene is absent in rodents [PMC3639327]. When overexpressed, MIR33B inhibits tumor growth and enhances survival in MM xenograft mouse models by inducing apoptosis through the suppression of proto-oncogene PIM-1 [PMC5721125][PMC7236745[PMC7236745]. MIR33B expression is influenced by lipid metabolism and can be regulated by statins like pitavastatin, which prevents its suppression by oxidized low-density lipoprotein (oxLDL) [PMC4945056]. It also plays a role in reducing metastasis and the epithelial-mesenchymal transition phenotype, with its silencing reversing cordycepin-mediated effects [PMC4496401]. Additionally, MIR33B expression can be epigenetically suppressed by PRMT5, which promotes lymphoma cell growth and survival through silencing tumor-suppressing miRNAs including MIR33B [PMC10147102][PMC10044308][PMC10044308]. In metabolic contexts, MIR33B has been associated with lipid homeostasis regulation alongside its host gene SREBF-1 and has been found to be upregulated in familial hypercholesterolemia cases, correlating with LDL cholesterol levels [PMC5113745][PMC3359973][PMC5085653[PMC3359973][PMC5085653].

Literature search
209 open access papers mention hsa-mir-33b
(1556 sentences)

Sequence

10824 reads, 33.0 reads per million, 148 experiments
gcgggcggccccgcgGUGCAUUGCUGUUGCAUUGCAcgugugugaggcgggugCAGUGCCUCGGCAGUGCAGCCCggagccggccccuggcaccac
(((((((((.(((.((((((((((((..(((((((((.(((.....))).)))))))))..)))))))))).))))).))).))))...)).....

Structure
-----  ---    -   c   c  -          UU         g   g 
     gc   gggc ggc ccg gG UGCAUUGCUG  GCAUUGCAc ugu u
     ||   |||| ||| ||| || ||||||||||  ||||||||| ||| g
     cg   cccg ccg ggC CC ACGUGACGGC  CGUGACgug gcg a
cacca  guc    g   a   -  G          UC         g   g 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr17: 17813836-17813931 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-33b
Name Accession Chromosome Start End Strand Confidence



Biological pathways
hsa-mir-33b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-33b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-33b-5p

Accession MIMAT0003301
Description Homo sapiens hsa-miR-33b-5p mature miRNA
Sequence 16 - GUGCAUUGCUGUUGCAUUGCA - 36
Evidence experimental
SAGE [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-33b-3p

Accession MIMAT0004811
Description Homo sapiens hsa-miR-33b-3p mature miRNA
Sequence 54 - CAGUGCCUCGGCAGUGCAGCCC - 75
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692