Stem-loop sequence hsa-mir-651

Accession

MI0003666 (change log)

Symbol

HGNC:MIR651

Description

Homo sapiens miR-651 stem-loop

Gene family

MIPF0000478; mir-651

Literature search

3 open access papers mention hsa-mir-651
(3 sentences)

Stem-loop

   ---------aau  a   c              a    ga       ucaaa 
5'             cu uca ugcuuuuuaggaua gcuu  cuuuugu     u
               || ||| |||||||||||||| ||||  |||||||      
3'             ga agu acggaaaauccuau ugaa  gaaaacg     a
   uuuguguaauuu  c   a              g    ag       uaaaa 

Deep sequencing

8136 reads, 7.38 reads per million, 149 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chrX: 8126965-8127061 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR651
• HGNC:MIR651
• RNAcentral:URS0000651B6D_9606
• miRBase Tracker:MI0003666

Mature sequence hsa-miR-651-5p

• Accession: MIMAT0003321
• Sequence: 16 - uuuaggauaagcuugacuuuug - 37
• Deep sequencing: 8027 reads, 147 experiments
• Evidence: experimental; RT-PCR [1], SAGE [1], cloned [2], Illumina [3]
• Database links:
  • RNAcentral:URS000049FAE8_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-651-5p
  • miRDB:hsa-miR-651-5p
  • microrna.org:hsa-miR-651-5p

Mature sequence hsa-miR-651-3p

• Accession: MIMAT0026624
• Sequence: 54 - aaaggaaaguguauccuaaaag - 75
• Deep sequencing: 107 reads, 39 experiments
• Evidence: experimental; Illumina [3]
• Database links:
  • RNAcentral:URS000075D3EF_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-651-3p
  • miRDB:hsa-miR-651-3p

References

1. PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).