Stem-loop hsa-mir-449b

Accession

MI0003673

Symbol

HGNC: MIR449B

Description

Homo sapiens hsa-mir-449b precursor miRNA mir-449

Gene
family

RF00711; mir-449

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR449B is a member of the miR-34/449 family, which includes six homologous microRNAs encoded by three distinct loci, playing a role in various cellular processes [PMC9855972]. Following ischemic injury to SVZ neural stem cells, MIR449B expression is altered, and its upregulation can be attenuated by both miR-449b inhibitor and Notch1 shRNA [PMC9405712]. MIR449B is highly homologous to miR449a and miR-449c [PMC6412851]'>PMC6412851], and it interacts with various genetic elements including pseudogenes, other microRNAs, and protein-coding genes [PMC9730017]. In the context of hepatocellular carcinoma (HCC), MIR449B has been implicated in the disease's progression through its binding sites found in mRNAs within cells treated with LM3 exosomes [PMC6412851]. Notably, a single nucleotide polymorphism (SNP) within MIR449B, rs10061133, has been identified as protective against sight-threatening diabetic retinopathy (DR) and proliferative DR [PMC7683113]. Additionally, sperm-born MIR449B appears to be involved in regulating the timing of the first cleavage during fertilization processes [PMC5645405], with a common polymorphism in MIR449B being significantly associated with decreased risk of proliferative DR in Caucasian patients with type 1 diabetes mellitus (T1DM) [PMC8421969].

Literature search

83 open access papers mention hsa-mir-449b
(414 sentences)

Sequence

4378 reads, 514 reads per million, 49 experiments

ugaccugaaucagguAGGCAGUGUAUUGUUAGCUGGCugcuugggucaagucagCAGCCACAACUACCCUGCCACUugcuucuggauaaauucuucu
...((.(((.(((((.(((((.(((..(((.(.((((((((.((......))))))))))))))))).)))))))))).))).))............

Structure

---------uga  u   u     A     U   UU   A C        u  gu 
            cc gaa caggu GGCAG GUA  GUU G UGGCugcu gg  c
            || ||| ||||| ||||| |||  ||| | |||||||| ||   
            gg cuu guUCA CCGUC CAU  CAA C ACCGACga cu  a
ucuucuuaaaua  u   c     -     C   --   - -        -  ga 

Annotation confidence High

Genome context

chr5: 55170646-55170742 [-]

Clustered miRNAs

2 other miRNAs are < 10 kb from hsa-mir-449b

Disease association

hsa-mir-449b is associated with one or more human diseases in the Human microRNA Disease Database

Biological pathways

hsa-mir-449b is involved in one or more biological pathways:

(Source: Reactome)

Biological reactions

hsa-mir-449b is involved in one or more regulation/signalling events:

(Source: Reactome)

Mature hsa-miR-449b-5p

• Accession: MIMAT0003327
• Description: Homo sapiens hsa-miR-449b-5p mature miRNA
• Sequence: 16 - AGGCAGUGUAUUGUUAGCUGGC - 37
• Evidence: experimental ; Microarray [1], RT-PCR [1], SAGE [1], cloned [2]

Mature hsa-miR-449b-3p

• Accession: MIMAT0009203
• Description: Homo sapiens hsa-miR-449b-3p mature miRNA
• Sequence: 55 - CAGCCACAACUACCCUGCCACU - 76
• Evidence: experimental ; 454 [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 19144710
   Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
   "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
   "J Virol (2009) 83:3333-3341


3. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692