miRBase entry: hsa-mir-449b

Stem-loop hsa-mir-449b


Accession
MI0003673
Symbol
HGNC: MIR449B
Description
Homo sapiens hsa-mir-449b precursor miRNA mir-449
Gene
family?
RF00711; mir-449

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR449B is a member of the miR-34/449 family, which includes six homologous microRNAs encoded by three distinct loci, playing a role in various cellular processes [PMC9855972]. Following ischemic injury to SVZ neural stem cells, MIR449B expression is altered, and its upregulation can be attenuated by both miR-449b inhibitor and Notch1 shRNA [PMC9405712]. MIR449B is highly homologous to miR449a and miR-449c [PMC6412851]'>PMC6412851], and it interacts with various genetic elements including pseudogenes, other microRNAs, and protein-coding genes [PMC9730017]. In the context of hepatocellular carcinoma (HCC), MIR449B has been implicated in the disease's progression through its binding sites found in mRNAs within cells treated with LM3 exosomes [PMC6412851]. Notably, a single nucleotide polymorphism (SNP) within MIR449B, rs10061133, has been identified as protective against sight-threatening diabetic retinopathy (DR) and proliferative DR [PMC7683113]. Additionally, sperm-born MIR449B appears to be involved in regulating the timing of the first cleavage during fertilization processes [PMC5645405], with a common polymorphism in MIR449B being significantly associated with decreased risk of proliferative DR in Caucasian patients with type 1 diabetes mellitus (T1DM) [PMC8421969].

Literature search
131 open access papers mention hsa-mir-449b
(469 sentences)

Sequence

1722 reads, 18.0 reads per million, 57 experiments
ugaccugaaucagguAGGCAGUGUAUUGUUAGCUGGCugcuugggucaagucagCAGCCACAACUACCCUGCCACUugcuucuggauaaauucuucu
...((.(((.(((((.(((((.(((..(((.(.((((((((.((......))))))))))))))))).)))))))))).))).))............

Structure
---------uga  u   u     A     U   UU   A C        u  gu 
            cc gaa caggu GGCAG GUA  GUU G UGGCugcu gg  c
            || ||| ||||| ||||| |||  ||| | |||||||| ||   
            gg cuu guUCA CCGUC CAU  CAA C ACCGACga cu  a
ucuucuuaaaua  u   c     -     C   --   - -        -  ga 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr5: 55170646-55170742 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-449b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-449b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-449b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-449b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-449b-5p

Accession MIMAT0003327
Description Homo sapiens hsa-miR-449b-5p mature miRNA
Sequence 16 - AGGCAGUGUAUUGUUAGCUGGC - 37
Evidence experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-449b-3p

Accession MIMAT0009203
Description Homo sapiens hsa-miR-449b-3p mature miRNA
Sequence 55 - CAGCCACAACUACCCUGCCACU - 76
Evidence experimental
454 [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 19144710
    Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
    "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
    "J Virol (2009) 83:3333-3341

  3. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692