miRBase entry: hsa-mir-411

Stem-loop hsa-mir-411


Accession
MI0003675
Symbol
HGNC: MIR411
Description
Homo sapiens hsa-mir-411 precursor miRNA mir-379
Gene
family?
RF04292; mir-379

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR411 is a microRNA that has been implicated in various biological processes and diseases, including Alzheimer's disease (AD) and idiopathic pulmonary fibrosis (IPF) [PMC7564652]'>PMC7564652], [PMC9930250]. It is one of several miRNAs that are upregulated in diseased human bronchial epithelial cell-derived small extracellular vesicles (sEVs), although it is not a target of Drp1 but rather Drp1 is a target of MIR411, which is involved in mitochondrial dynamics [PMC9626984], [PMC9930250]. In the context of AD, MIR411 is downregulated in the cortex of patients, suggesting a potential role in the disease's pathogenesis; however, its specific function and targets within AD are not yet clear [PMC7564652]. Additionally, MIR411 has been found to be expressed at higher levels in fibroblasts compared to D492 breast epithelial cells and is one of the most differentially expressed miRNAs located on chromosome 8 in the dog reference genome CanFam3.1 [PMC7308478], [PMC8376273]. It has also been included as part of a microRNA model to distinguish lymph node metastasis (LNM) in colorectal cancer (CRC), indicating its potential utility as a biomarker for cancer progression [PMC9614158]. Furthermore, MIR411 is involved in anti-inflammatory processes as it was found to be expressed at high levels within bone marrow stem cell-derived exosomes which modulate inflammatory pathways [PMC7897935], [PMC9069372].

Literature search
33 open access papers mention hsa-mir-411
(135 sentences)

Sequence

10840 reads, 38 reads per million, 99 experiments
ugguacuuggagagaUAGUAGACCGUAUAGCGUACGcuuuaucugugacgUAUGUAACACGGUCCACUAACCcucaguaucaaauccauccccgag
(((((((..(((.(.((((.((((((...((((((((.........).)))))))...)))))).)))).).))))))))))..............

Structure
--------------       ug   a a    A      AUA       - uuu 
              ugguacu  gag g UAGU GACCGU   GCGUACG c   a
              |||||||  ||| | |||| ||||||   ||||||| |   u
              acuauga  cuc C AUCA CUGGCA   UGUAUgc g   c
gagccccuaccuaa       --   C A    C      CAA       a ugu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101023325-101023420 [+]
Clustered miRNAs
11 other miRNAs are < 10 kb from hsa-mir-411
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-411 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-411-5p

Accession MIMAT0003329
Description Homo sapiens hsa-miR-411-5p mature miRNA
Sequence 16 - UAGUAGACCGUAUAGCGUACG - 36
Evidence experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-411-3p

Accession MIMAT0004813
Description Homo sapiens hsa-miR-411-3p mature miRNA
Sequence 51 - UAUGUAACACGGUCCACUAACC - 72
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692