Stem-loop sequence dre-mir-34b

AccessionMI0003690 (change log)
DescriptionDanio rerio miR-34b stem-loop
Gene family MIPF0000039; mir-34
Literature search

10 open access papers mention dre-mir-34b
(35 sentences)

Stem-loop
   --g      guc   a        u     c       --   a 
5'    ggguug   ugu ggcagugu guuag ugauugu  uuc u
      ||||||   ||| |||||||| ||||| |||||||  |||  
3'    uccaac   aca ccgucaua caauc acuaaua  aag a
   aca      aac   a        c     -       uc   u 
Get sequence
Deep sequencing
233 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 57922520-57922604 [-]
intergenic
KZ115154.1: 111710-111794 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-34b
dre-mir-34bchr5: 57922520-57922604 [-]
dre-mir-34cchr5: 57922284-57922367 [-]
Database links

Mature sequence dre-miR-34b

Accession MIMAT0003346
Sequence

13 - 

uaggcaguguuguuagcugauug

 - 35

Get sequence
Deep sequencing222 reads, 5 experiments
Evidence experimental; in-situ [1]
Database links
Predicted targets

References

1
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).