Stem-loop sequence dre-mir-34b

AccessionMI0003690 (change log)
DescriptionDanio rerio miR-34b stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --g      guc   a        u     c       --   a 
5'    ggguug   ugu ggcagugu guuag ugauugu  uuc u
      ||||||   ||| |||||||| ||||| |||||||  |||  
3'    uccaac   aca ccgucaua caauc acuaaua  aag a
   aca      aac   a        c     -       uc   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 57922520-57922604 [-]
intergenic
KZ115154.1: 111710-111794 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-34b
dre-mir-34bchr5: 57922520-57922604 [-]
dre-mir-34cchr5: 57922284-57922367 [-]
Database links

Mature sequence dre-miR-34b

Accession MIMAT0003346
Sequence

13 - 

uaggcaguguuguuagcugauug

 - 35

Get sequence
Evidence experimental; in-situ [1]
Database links
Predicted targets

References

1
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).