Stem-loop sequence dre-mir-135a

AccessionMI0003692 (change log)
DescriptionDanio rerio miR-135a stem-loop
Gene family MIPF0000028; mir-135
Literature search

3 open access papers mention dre-mir-135a
(4 sentences)

Stem-loop
   -----------aca    u     c   -      uu             a g ga 
5'               gcug cgugu uua uggcuu  uauuccuauguga g u  a
                 |||| ||||| ||| ||||||  ||||||||||||| | |   
3'               ugac gcaca aau accgaa  auagggauguacu c g  c
   uuucgacuaaagac    -     -   c      -c             - g aa 
Get sequence
Deep sequencing
303 reads, 12.5 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr25: 31044110-31044207 [-]
intergenic
Database links

Mature sequence dre-miR-135a

Accession MIMAT0003348
Sequence

16 - 

uauggcuuuuuauuccuauguga

 - 38

Get sequence
Deep sequencing300 reads, 8 experiments
Evidence experimental; array [1]
Database links
Predicted targets

References

1
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).