Stem-loop sequence dre-mir-139

AccessionMI0003693 (change log)
DescriptionDanio rerio miR-139 stem-loop
Gene family MIPF0000117; mir-139
Stem-loop
   cug       -      a   g        -   u 
5'    uauucua cagugc ugu ucuccagu guu c
      ||||||| |||||| ||| |||||||| ||| u
3'    auaaggu gucgcg acg agggguca cgg a
   -ca       u      -   g        g   u 
Get sequence
Deep sequencing
2366 reads, 110 reads per million, 10 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dre-miR-139-5p

Accession MIMAT0003349
Previous IDsdre-miR-139
Sequence

7 - 

ucuacagugcaugugucu

 - 24

Get sequence
Deep sequencing2273 reads, 10 experiments
Evidence experimental; in-situ [1]
Database links
Predicted targets

Mature sequence dre-miR-139-3p

Accession MIMAT0032008
Sequence

44 - 

uggggaggcagcgcuguuggaau

 - 66

Get sequence
Deep sequencing93 reads, 7 experiments
Evidence not experimental
Database links

References

1
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).