Stem-loop sequence gga-mir-375

AccessionMI0003705 (change log)
DescriptionGallus gallus miR-375 stem-loop
Gene family MIPF0000114; mir-375
Literature search

15 open access papers mention gga-mir-375
(98 sentences)

Stem-loop
   -       u      cc   u       c ga 
5'  ccuggcg cgagcc  acg gcaagac u  c
    ||||||| ||||||  ||| ||||||| |  c
3'  ggauugc gcucgg  ugc uguuuug a  u
   c       -      cu   u       c ag 
Get sequence
Deep sequencing
1804 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr7: 22469940-22470004 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-375
gga-mir-375chr7: 22469940-22470004 [+]
gga-mir-1788chr7: 22479317-22479404 [+]
Database links

Mature sequence gga-miR-375

Accession MIMAT0003362
Sequence

41 - 

uuuguucguucggcucgcguua

 - 62

Get sequence
Deep sequencing1803 reads, 5 experiments
Evidence by similarity; MI0000783
Database links
Predicted targets