Stem-loop sequence rno-mir-378a

AccessionMI0003719 (change log)
Previous IDsrno-mir-378
DescriptionRattus norvegicus miR-378 stem-loop
Gene family MIPF0000168; mir-378
Literature search

27 open access papers mention rno-mir-378a
(117 sentences)

Stem-loop 
   -  g  c              ugu      ccu 
5'  gg cu cugacuccaggucc   guguua   c
    || || ||||||||||||||   ||||||    
3'  cc ga gacugagguucagg   cacgau   g
   u  g  a              --u      aaa
Get sequence
Deep sequencing
16685861 reads, 1.34e+04 reads per million, 508 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr18: 56726150-56726214 [-]
sense
ENSRNOT00000023661 ; Ppargc1b-202; intron 1
antisense
ENSRNOT00000053640 ; Mir3557-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-378a
rno-mir-378achr18: 56726150-56726214 [-]
rno-mir-3557chr18: 56726128-56726240 [+]
Database links

Mature sequence rno-miR-378a-5p

Accession MIMAT0003378
Previous IDsrno-miR-378;rno-miR-378*
Sequence

4 -  

cuccugacuccagguccugugu

 - 25

Get sequence
Deep sequencing108193 reads, 489 experiments
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-378a-3p

Accession MIMAT0003379
Previous IDsrno-miR-422b;rno-miR-378
Sequence

42 -  

acuggacuuggagucagaagg

 - 62

Get sequence
Deep sequencing16577651 reads, 508 experiments
Evidence experimental; cloned [1-2], Northern [1], SOLiD [3]
Predicted targets

References

1
PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).