miRBase entry: ebv-mir-BART9

Stem-loop ebv-mir-BART9


Accession
MI0003731
Description
Epstein Barr virus ebv-mir-BART9 precursor miRNA
Gene family
MIPF0000955; mir-BART9


Sequence

cagcuguuguuugUACUGGACCCUGAAUUGGAAACaguaacuuggauucugUAACACUUCAUGGGUCCCGUAGUgacaacuaugcug
((((.((((((..(((.((((((((((.((...((((...........))))..)).)))).)))))).)))..))))))...))))

Structure
    --u      ug   U      -    U  GAA    uaac 
cagc   guuguu  UAC GGACCC UGAA UG   ACag    u
||||   ||||||  ||| |||||| |||| ||   ||||    u
gucg   caacag  AUG CCUGGG ACUU AC   Uguc    g
    uau      UG   C      U    C  -AA    uuag 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
mir-BART9 was discovered independently by two groups. Cai et al mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 3' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence was misnamed miR-BART13 in [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
HHV507799: 146946-147032 [+]
Clustered miRNAs
21 other miRNAs are < 10 kb from ebv-mir-BART9
Name Accession Chromosome Start End Strand Confidence




Disease association
ebv-mir-BART9 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature ebv-miR-BART9-5p

Accession MIMAT0004816
Description Epstein Barr virus ebv-miR-BART9-5p mature miRNA
Sequence 14 - UACUGGACCCUGAAUUGGAAAC - 35
Evidence experimental
cloned [3]

Mature ebv-miR-BART9-3p

Accession MIMAT0003419
Description Epstein Barr virus ebv-miR-BART9-3p mature miRNA
Sequence 52 - UAACACUUCAUGGGUCCCGUAGU - 74
Evidence experimental
cloned [1,3], array [2], Northern [2]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16557291
    Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed
    Cai X, Schäfer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR
    PLoS Pathog (2006) 2:e23

  3. PubMed ID: 16540699
    A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
    "Grundhoff A, Sullivan CS, Ganem D"
    "RNA (2006) 12:733-750