miRBase entry: ebv-mir-BART14

Stem-loop ebv-mir-BART14


Accession
MI0003736
Description
Epstein Barr virus ebv-mir-BART14 precursor miRNA
Gene family
MIPF0000959; mir-BART14


Sequence

cagggguggccggUACCCUACGCUGCCGAUUUACAuaauauaaauugUAAAUGCUGCAGUAGUAGGGAUcuggacgcgcgaccug
((((.((((((((..(((((((((((.((((((((..........))))))).).))))).))))))..)))).).)))..))))

Structure
    -g   - -    UA      -     C -       uaau 
cagg  gug g ccgg  CCCUAC GCUGC G AUUUACA    a
||||  ||| | ||||  |||||| ||||| | |||||||     
gucc  cgc c gguc  GGGAUG UGACG C UAAAUgu    u
    ag   g a    UA      A     U G       uaaa 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
mir-BART14 was discovered independently by two groups. Cai et al identified a mature miRNA products from the 5' arm of the hairpin precursor and mapped the ends of the mature sequence by cloning [1]. Grundhoff et al report that both arms give rise to a mature miRNA products, but didnot experimentally determine the extents of those products [2]. The ends of ebv-miR-BART14-3p are therefore predicted, not experimentally determined. This sequence is nisnamed miR-BART20 in [2]. The mature miRNA names reflect cloning frequencies from Landgraf et al. [3], and may differ subtly from previous annotations.

Genome context
HHV507799: 148731-148815 [+]
Clustered miRNAs
21 other miRNAs are < 10 kb from ebv-mir-BART14
Name Accession Chromosome Start End Strand Confidence




Disease association
ebv-mir-BART14 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature ebv-miR-BART14-5p

Accession MIMAT0003425
Description Epstein Barr virus ebv-miR-BART14-5p mature miRNA
Sequence 14 - UACCCUACGCUGCCGAUUUACA - 35
Evidence experimental
cloned [1,3], array [2], Northern [2]

Mature ebv-miR-BART14-3p

Accession MIMAT0003426
Description Epstein Barr virus ebv-miR-BART14-3p mature miRNA
Sequence 48 - UAAAUGCUGCAGUAGUAGGGAU - 69
Evidence experimental
array [2], Northern [2], cloned [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16557291
    Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed
    Cai X, Schäfer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR
    PLoS Pathog (2006) 2:e23

  3. PubMed ID: 16540699
    A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
    "Grundhoff A, Sullivan CS, Ganem D"
    "RNA (2006) 12:733-750