Stem-loop sequence ebv-mir-BART14

Accession MI0003736
Description Epstein Barr virus miR-BART14 stem-loop
Gene family MIPF0000959; mir-BART14
Stem-loop 
    -g   - -    ua      -     c -       uaau 
cagg  gug g ccgg  cccuac gcugc g auuuaca    a
||||  ||| | ||||  |||||| ||||| | |||||||     
gucc  cgc c gguc  gggaug ugacg c uaaaugu    u
    ag   g a    ua      a     u g       uaaa
Get sequence
Comments

mir-BART14 was discovered independently by two groups. Cai et al identified a mature miRNA products from the 5' arm of the hairpin precursor and mapped the ends of the mature sequence by cloning [1]. Grundhoff et al report that both arms give rise to a mature miRNA products, but didnot experimentally determine the extents of those products [2]. The ends of ebv-miR-BART14-3p are therefore predicted, not experimentally determined. This sequence is nisnamed miR-BART20 in [2]. The mature miRNA names reflect cloning frequencies from Landgraf et al. [3], and may differ subtly from previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 148731-148815 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART14
ebv-mir-BART3 HHV507799: 139076-139154 [+]
ebv-mir-BART4 HHV507799: 139220-139295 [+]
ebv-mir-BART1 HHV507799: 139346-139415 [+]
ebv-mir-BART15 HHV507799: 139507-139584 [+]
ebv-mir-BART5 HHV507799: 139661-139749 [+]
ebv-mir-BART16 HHV507799: 139776-139874 [+]
ebv-mir-BART17 HHV507799: 139894-139995 [+]
ebv-mir-BART6 HHV507799: 140016-140107 [+]
ebv-mir-BART21 HHV507799: 145503-145578 [+]
ebv-mir-BART18 HHV507799: 145932-146050 [+]
ebv-mir-BART7 HHV507799: 146425-146510 [+]
ebv-mir-BART8 HHV507799: 146759-146840 [+]
ebv-mir-BART9 HHV507799: 146946-147032 [+]
ebv-mir-BART22 HHV507799: 147161-147231 [+]
ebv-mir-BART10 HHV507799: 147304-147393 [+]
ebv-mir-BART11 HHV507799: 147524-147609 [+]
ebv-mir-BART12 HHV507799: 147888-147970 [+]
ebv-mir-BART19 HHV507799: 148198-148290 [+]
ebv-mir-BART20 HHV507799: 148319-148417 [+]
ebv-mir-BART13 HHV507799: 148512-148597 [+]
ebv-mir-BART14 HHV507799: 148731-148815 [+]
ebv-mir-BART2 HHV507799: 152745-152806 [+]

Mature sequence ebv-miR-BART14-5p

Accession MIMAT0003425
Previous IDs ebv-miR-BART14-5p;ebv-miR-BART14*
Sequence

14 -  

uacccuacgcugccgauuuaca

 - 35

Get sequence
Evidence experimental; cloned [1,3], array [2], Northern [2]

Mature sequence ebv-miR-BART14-3p

Accession MIMAT0003426
Previous IDs ebv-miR-BART14-3p;ebv-miR-BART14
Sequence

48 -  

uaaaugcugcaguaguagggau

 - 69

Get sequence
Evidence experimental; array [2], Northern [2], cloned [3]

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
PMID:16540699 "A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses" Grundhoff A, Sullivan CS, Ganem D RNA. 12:733-750(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).