Stem-loop sequence mmu-mir-1247

AccessionMI0004120 (change log)
Symbol MGI:Mir1247
DescriptionMus musculus miR-1247 stem-loop
Gene family MIPF0000669; mir-1247
Literature search

3 open access papers mention mmu-mir-1247
(4 sentences)

Stem-loop
   cggccgc       a  c   c  uu   c     acguu  u 
5'        cgggcgc cc guc cg  cgu cccgg     gc c
          ||||||| || ||| ||  ||| |||||     || u
3'        gcccgcg gg cag gc  gca gggcc     cg c
   --gucaa       a  u   a  -u   a     ----c  u 
Get sequence
Deep sequencing
7002 reads, 30.7 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by sequencing [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 110278048-110278129 [-]
sense
ENSMUST00000181693 ; Dio3os-201; exon 1
Database links

Mature sequence mmu-miR-1247-5p

Accession MIMAT0014800
Previous IDsmmu-miR-1247
Sequence

15 - 

acccgucccguucguccccgga

 - 36

Get sequence
Deep sequencing5758 reads, 68 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-1247-3p

Accession MIMAT0014801
Previous IDsmmu-miR-1247*
Sequence

52 - 

cgggaacgucgagacuggagc

 - 72

Get sequence
Deep sequencing1234 reads, 34 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).