Stem-loop sequence mmu-mir-216b

Accession

MI0004126 (change log)

Symbol

MGI:Mir216b

Description

Mus musculus miR-216b stem-loop

Gene family

MIPF0000054; mir-216

Literature search

24 open access papers mention mmu-mir-216b
(81 sentences)

Stem-loop

   u  g        ga            c  a    --aug  ac 
5'  ug cagacugg  aaucucugcagg aa ugug     uc  u
    || ||||||||  |||||||||||| || ||||     ||   
3'  ac gucugacu  uuagagaugucc uu acac     ag  g
   a  a        uc            a  c    accaa  aa 

Deep sequencing

13038 reads, 63.3 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr11: 28746191-28746276 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mmu-mir-216b

• mmu-mir-216b: chr11: 28746191-28746276 [+]
• mmu-mir-216c: chr11: 28746198-28746266 [-]

Database links

• EntrezGene:Mir216b
• MGI:Mir216b
• RNAcentral:URS000075F08F_10090
• miRBase Tracker:MI0004126

Mature sequence mmu-miR-216b-5p

• Accession: MIMAT0003729
• Previous IDs: mmu-miR-216b
• Sequence: 14 - aaaucucugcaggcaaauguga - 35
• Deep sequencing: 12959 reads, 44 experiments
• Evidence: experimental; MPSS [1], cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS000046CDA6_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-216b-5p
  • miRDB:mmu-miR-216b-5p
  • microrna.org:mmu-miR-216b-5p

Mature sequence mmu-miR-216b-3p

• Accession: MIMAT0017233
• Previous IDs: mmu-miR-216b*
• Sequence: 54 - acacuuaccuguagagauucuu - 75
• Deep sequencing: 60 reads, 10 experiments
• Evidence: experimental; Illumina [4]
• Database links:
  • RNAcentral:URS0000073FCE_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-216b-3p
  • miRDB:mmu-miR-216b-3p

References

1. PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).