Stem-loop sequence mmu-mir-216b

Accession MI0004126
Symbol MGI:Mir216b
Description Mus musculus miR-216b stem-loop
Gene family MIPF0000054; mir-216
Stem-loop 
u  g        ga            c  a    --aug  ac 
 ug cagacugg  aaucucugcagg aa ugug     uc  u
 || ||||||||  |||||||||||| || ||||     ||   
 ac gucugacu  uuagagaugucc uu acac     ag  g
a  a        uc            a  c    accaa  aa
Get sequence
Deep sequencing
11399 reads, 45 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 28746191-28746276 [+]
intergenic
Database links

Mature sequence mmu-miR-216b-5p

Accession MIMAT0003729
Previous IDs mmu-miR-216b
Sequence

14 -  

aaaucucugcaggcaaauguga

 - 35

Get sequence
Deep sequencing 11057 reads, 31 experiments
Evidence experimental; MPSS [1], cloned [2], Solexa [3-4]
Predicted targets

Mature sequence mmu-miR-216b-3p

Accession MIMAT0017233
Previous IDs mmu-miR-216b*
Sequence

54 -  

acacuuaccuguagagauucuu

 - 75

Get sequence
Deep sequencing 44 reads, 6 experiments
Evidence experimental; Solexa [4]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).