![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-3475 |
|||||
Accession | MI0004220 (change log) | ||||
Symbol | MGI:Mir3475 | ||||
Description | Mus musculus miR-3475 stem-loop | ||||
Stem-loop |
-- acc ca -ucc u 5' caaaucaugu cc cagaggg aga g |||||||||| || ||||||| ||| 3' guuugguaca gg gucuucu ucu g aa --c ag ugau u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown by Illumina sequencing [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-3475-5p |
|
Accession | MIMAT0026642 |
Sequence |
2 - aaaucauguacccccacagagg - 23 |
Deep sequencing | 4 reads, 3 experiments |
Evidence | experimental; Illumina [3] |
Predicted targets |
|
Mature sequence mmu-miR-3475-3p |
|
Accession | MIMAT0015219 |
Sequence |
45 - ucuggaggcacaugguuugaa - 65 |
Deep sequencing | 1739 reads, 48 experiments |
Evidence | experimental; Illumina [2-3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
3 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|