Stem-loop sequence mmu-mir-761

AccessionMI0004306 (change log)
Symbol MGI:Mir761
DescriptionMus musculus miR-761 stem-loop
Gene family MIPF0000709; mir-761
Literature search

6 open access papers mention mmu-mir-761
(13 sentences)

Stem-loop
   u  ca   --                      g  a  g 
5'  gg  agu  ggaggagcagcagggugaaacu ac ca u
    ||  |||  |||||||||||||||||||||| || ||  
3'  cc  uca  ccuccucgucguuucacuuuga ug gu g
   a  -c   gu                      g  -  c 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 109017655-109017730 [+]
sense
OTTMUST00000064186 ; Nrd1-009; 3'UTR (exon 1)
OTTMUST00000018880 ; Nrd1-001; intron 2
OTTMUST00000064185 ; Nrd1-008; intron 2
OTTMUST00000018881 ; Nrd1-002; 3'UTR (exon 4)
ENSMUST00000125645 ; Nrd1-009; 3'UTR (exon 1)
ENSMUST00000065977 ; Nrd1-001; intron 2
ENSMUST00000102736 ; Nrd1-008; intron 2
ENSMUST00000106644 ; Nrd1-002; 3'UTR (exon 4)
Database links

Mature sequence mmu-miR-761

Accession MIMAT0003893
Sequence

15 - 

gcagcagggugaaacugacaca

 - 36

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Northern [1], RAKE [1]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).