Stem-loop sequence mmu-mir-3106

AccessionMI0004486 (change log)
Symbol MGI:Mir3106
DescriptionMus musculus miR-3106 stem-loop
Stem-loop
       a        -u       u  gaa        a ac 
5' aggg agcacagg  ggcucau ua   gcagccau c  u
   |||| ||||||||  ||||||| ||   |||||||| |  c
3' ucuc ucgugucc  ucgggua au   cgucggug g  a
       c        uu       c  auc        a ag 
Get sequence
Deep sequencing
763 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by sequencing [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 16168757-16168838 [-]
sense
OTTMUST00000085821 ; Csmd1-003; intron 23
OTTMUST00000085800 ; Csmd1-001; intron 23
ENSMUST00000082104 ; Csmd1-001; intron 23
ENSMUST00000131778 ; Csmd1-003; intron 23
Database links

Mature sequence mmu-miR-3106-5p

Accession MIMAT0014817
Previous IDsmmu-miR-3106
Sequence

14 - 

uggcucauuuagaagcagcca

 - 34

Get sequence
Deep sequencing702 reads, 28 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-3106-3p

Accession MIMAT0014818
Previous IDsmmu-miR-3106*
Sequence

50 - 

gcugccuauacaugggcuuucc

 - 71

Get sequence
Deep sequencing11 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).