Stem-loop sequence mmu-mir-497a

Accession

MI0004636 (change log)

Previous IDs

mmu-mir-497

Description

Mus musculus miR-497 stem-loop

Gene family

MIPF0000231; mir-497

Literature search

45 open access papers mention mmu-mir-497a
(603 sentences)

Stem-loop

   cc     c   c c    g    c         u  --   ac 
5'   ugccc cgc c agca caca ugugguuug ac  ggc  u
     ||||| ||| | |||| |||| ||||||||| ||  |||   
3'   auggg gcg g uugu gugu acaccaaac ug  ccg  g
   --     a   a a    g    c         c  ca   gu 

Deep sequencing

92702 reads, 615 reads per million, 109 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr11: 70234717-70234800 [+]
• Overlapping transcripts:

  antisense

  ENSMUST00000093601 ; Mir497-201; exon 1

Clustered miRNAs

< 10kb from mmu-mir-497a

• mmu-mir-497b: chr11: 70234692-70234816 [-]
• mmu-mir-497a: chr11: 70234717-70234800 [+]
• mmu-mir-195a: chr11: 70235042-70235135 [+]

Database links

• EntrezGene:Mir497
• RNAcentral:URS000075DE0E_10090
• miRBase Tracker:MI0004636

Mature sequence mmu-miR-497a-5p

• Accession: MIMAT0003453
• Previous IDs: mmu-miR-497-5p
• Sequence: 14 - cagcagcacacugugguuugua - 35
• Deep sequencing: 91194 reads, 102 experiments
• Evidence: experimental; MPSS [1], cloned [2], Illumina [3,5]
• Database links:
  • RNAcentral:URS00002AE1D6_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-497a-5p
  • miRDB:mmu-miR-497a-5p
  • microrna.org:mmu-miR-497a-5p

Mature sequence mmu-miR-497a-3p

• Accession: MIMAT0017247
• Previous IDs: mmu-miR-497-3p
• Sequence: 54 - caaaccacacugugguguuag - 74
• Deep sequencing: 1304 reads, 45 experiments
• Evidence: experimental; 454 [4], Illumina [5]
• Database links:
  • RNAcentral:URS00005A753E_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-497a-3p
  • miRDB:mmu-miR-497a-3p

References

1. PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).