![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-497a |
||||||||
Accession | MI0004636 (change log) | |||||||
Previous IDs | mmu-mir-497 | |||||||
Description | Mus musculus miR-497 stem-loop | |||||||
Gene family | MIPF0000231; mir-497 | |||||||
Literature search |
![]()
45 open access papers mention mmu-mir-497a | |||||||
Stem-loop |
cc c c c g c u -- ac 5' ugccc cgc c agca caca ugugguuug ac ggc u ||||| ||| | |||| |||| ||||||||| || ||| 3' auggg gcg g uugu gugu acaccaaac ug ccg g -- a a a g c c ca gu |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence mmu-miR-497a-5p |
|
Accession | MIMAT0003453 |
Previous IDs | mmu-miR-497-5p |
Sequence |
14 - cagcagcacacugugguuugua - 35 |
Deep sequencing | 91194 reads, 102 experiments |
Evidence | experimental; MPSS [1], cloned [2], Illumina [3,5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-497a-3p |
|
Accession | MIMAT0017247 |
Previous IDs | mmu-miR-497-3p |
Sequence |
54 - caaaccacacugugguguuag - 74 |
Deep sequencing | 1304 reads, 45 experiments |
Evidence | experimental; 454 [4], Illumina [5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|